Subgenomic mRNA

Subgenomic mRNA

Subgenomic mRNA's are essentially smaller sections of the original transcribed template strand. During transcription, the original template strand is usually read from the 3' to the 5' end from beginning to end. Subgenomic mRNAs are created when transcription begins at the 3' end of the template strand (or 5' of the to-be-newly synthesized template) and begins to copy towards the 5' end of the template strand before "jumping" to the end of the template and copying the 5' end of the template, creating a 3' tail for the newly created strand. As a result, the newly created strand will have similar 5' ends to varying degrees with the original template (depending on when the transcription began the jump) and similar 3' ends to the template [Wu B, White KA. "Uncoupling RNA virus replication from transcription via the polymerase: functional and evolutionary insights." EMBO J. 2007 Nov 22] .

The result is many different proteins created from the different lengths of mRNA created from the same strand with similar 5' ends (to varying degrees) and same 3' ends. The similar 5' sections on the newly created strand is a result of the same section being copied from the template strand, and this section on the template strand is referred to as the "nested set" [Le TM, Wong HH, Tay FP, Fang S, Keng CT, Tan YJ, Liu DX. "Expression, post-translational modification and biochemical characterization of proteins encoded by subgenomic mRNA8 of the severe acute respiratory syndrome coronavirus." FEBS J. 2007 Aug;274(16):4211-22. Epub 2007 Jul 20.] .

GCCGCCCCGTATCGATCGTAGCGCACGTTATATATACGTTATTTCTGCGCGGAAAAAAAAA - Original Strand GCCGCCCCGTATCGATCGTAGCGCACGTTATATATACAAAAAAAAA
GCCGCCCCGTATCGATCGTAGCGCACAAAAAAAAA | = Subgenomic mRNA GCCGCCCCGTATAAAAAAAAA
GCCGCCCCGTAT = Nested Set

Examples

This complex method of transcription is generally restricted to viruses, especially those of the single-stranded, positive-sense RNA or Class IV viruses using the Baltimore Classification System. Its use is primarily used for compacting more genetic information into a shorter amount of genetic material [Xu W, White KA. "Subgenomic mRNA transcription in an aureusvirus: Down-regulation of transcription and evolution of regulatory RNA elements." Virology. 2007 Nov 5] .

Literature

please correct the references; it is 26 not 22 volumethe first one is:Wu, Baodong & White, K.A. 2007. Uncoupling RNA virus replication from transcription via the polymerase: functional and evolutionary insights. The EMBO Journal. 26, 5120–5130


Wikimedia Foundation. 2010.

Игры ⚽ Поможем решить контрольную работу

Look at other dictionaries:

  • subgenomic promoter — A promoter added to a virus for a specific heterologous gene, resulting in the formation of mRNA for that gene alone …   Glossary of Biotechnology

  • Rabbit haemorrhagic disease virus — Taxobox regnum = Viruses virus group = familia = Caliciviridae genus = Lagovirus species = Rabbit haemorrhagic disease virus Rabbit haemorrhagic disease virus (RHDV), also known as rabbit calicivirus (RCV), is the type species of the genus… …   Wikipedia

  • Alfalfa mosaic virus — Taxobox virus group = IV familia = Bromoviridae genus = Alfamovirus species = Alfalfa mosaic virus Alfalfa mosaic virus (AMV), also known as Lucerne mosaic virus or Potato calico virus , is a worldwide distributed phytopathogen that can lead to… …   Wikipedia

  • Coronavirus — Virus classification Group: Group IV ((+)ssRNA) Order …   Wikipedia

  • Bunyaviridae — Taxobox name = Bunyaviridae virus group = v familia = Bunyaviridae subdivision ranks = Genus subdivision = Hantavirus Nairovirus Orthobunyavirus Phlebovirus Tospovirus Bunyaviridae is a family of negative stranded RNA viruses. Though generally… …   Wikipedia

  • Virus ARN monocatenario positivo —   Virus ARN monocatenario positivo Calicivirus …   Wikipedia Español

  • Idaeovirus — Taxobox | color=violet image width = image caption = name = Idaeovirus virus group = iv familia = None Currently Assigned genus = Idaeovirus The Idaeovirus refers to a genus of a plant virus with currently no assigned family or order. Virus… …   Wikipedia

  • Torovirus — Taxobox | color=violet image width = 180px image caption = name = Torovirus virus group = iv familia = Coronaviridae genus = Torovirus The Torovirus is a genus of viruses that are under the Coronaviridae family that primarily infect vertebrates.… …   Wikipedia

  • SND1 — Staphylococcal nuclease and tudor domain containing 1, also known as SND1, is a human gene.cite web | title = Entrez Gene: SND1 staphylococcal nuclease and tudor domain containing 1| url = http://www.ncbi.nlm.nih.gov/sites/entrez?Db=gene… …   Wikipedia

  • Luteovirus cap-independent translation element (BTE) — The Luteovirus cap independent translation element (BTE) is an RNA element found in the 3 UTR of barley yellow dwarf virus (BYDV), bean leafroll virus and soybean dwarf virus. This element mediates translation of genomic RNA and subgenomic RNA1… …   Wikipedia

Share the article and excerpts

Direct link
Do a right-click on the link above
and select “Copy Link”